Lade Inhalt...

In der Falle rätselhafter Kräfte

©2018 160 Seiten

Zusammenfassung

Merkwürdige Gestalten aus der Südsee besuchen die Forschungsstadt Gijutsu in Japan und bringen gefährliche Lebensformen mit, schleimförmige Wesen, die brutal töten und deren Zusammensetzung auf einen nicht-irdischen Ursprung hindeutet. Können Gijutsus Forscher die eingedrungene, mit molekularen Waffen kämpfende Macht und vor allem die beiden Anführer, Cthulhu und Professor Mübareg, besiegen und Gijutsu vor dem Untergang retten?
Das Debut des Schweizer Autors in der Edition Bärenklau- weitere Geschichten folgen... so Cthulhu, R’lyeh und die anderen der Großen Alten es wollen!
„Denn es ist nicht tot, was ewig liegt, bis dass die Zeit den Tod besiegt."

Leseprobe

Table of Contents

Title Page

In der Falle rätselhafter Kräfte

Klappentext:

Roman:

HUBERT HUG

 

In der Falle rätselhafter Kräfte

 

Ein Cthulhu-Roman

 

 

IMPRESSUM

 

Ein CassiopeiaPress Buch: CASSIOPEIAPRESS, UKSAK E-Books und BEKKERpublishing sind Imprints von Alfred Bekker

© Roman by Author/ Titelbild:Mark Turner/ 123RF mit Steve Mayer, 2018

© dieser Ausgabe 2018 by AlfredBekker/CassiopeiaPress, Lengerich/Westfalen in Arrangement mit der Edition Bärenklau, herausgegeben von Jörg Martin Munsonius.

www.AlfredBekker.de

postmaster@alfredbekker.de

 

Klappentext:

Merkwürdige Gestalten aus der Südsee besuchen die Forschungsstadt Gijutsu in Japan und bringen gefährliche Lebensformen mit, schleimförmige Wesen, die brutal töten und deren Zusammensetzung auf einen nicht-irdischen Ursprung hindeutet. Können Gijutsus Forscher die eingedrungene, mit molekularen Waffen kämpfende Macht und vor allem die beiden Anführer, Cthulhu und Professor Mübareg, besiegen und Gijutsu vor dem Untergang retten?

Das Debut des Schweizer Autors in der Edition Bärenklau- weitere Geschichten folgen... so Cthulhu, R’lyeh und die anderen der Großen Alten es wollen!

„Denn es ist nicht tot, was ewig liegt, bis dass die Zeit den Tod besiegt."

 

 

Roman:

Unser Besucher mit der Knollennase, der runzeligen Haut und dem zerrissenen Hemd, angeblich der einzige Überlebende einer Forschergruppe, die in die Südsee gereist war, um nach einer neuen Korallenart zu suchen, verschwieg uns seine Pläne und seinen Namen. Wenn wir – das waren Suze und ich – ihn danach fragten, öffnete er seinen Mund, riss dabei die Augen mit gezackten Pupillen, deren Ränder gelb leuchteten, so weit auf, dass die Iris rundum von Weiß umgeben war und wir befürchteten, die Augäpfel fielen heraus. Mit einem pfeifenden Geräusch, das tief aus der Lunge kam, hauchte er einen faulig riechenden Atem aus. Er war buckelig, wodurch er einem Zwerg glich, und über die Backen hingen lange, rot-graue Haare. Er drehte sich von uns weg, wenn wir ihm seine Mahlzeiten brachten. Als es beim Frühstück Krabben gab, murmelte er beim Kauen etwas wie: „Ph’nglui mglw’nafh Cthulhu R’lyeh wgah’nagl fhtagn.“ Noch während ich ihn bat, das zu wiederholen, starrte er mich erschrocken an und sein Kiefer zuckte. Dann rannte er in sein Zimmer – wir hatten ihm eines unserer Gästezimmer im ersten Stock zugewiesen – und schob das Bett vor die Tür, denn den Schlüssel hatten wir herausgezogen.

 

Diese Abschottungen hielten nur kurz an. Er schlich mir später hinterher, als beabsichtigte er, mit mir in Kontakt zu treten, doch bei jeder Begegnung starrte er mich an, als würde ich ihn bedrohen, bevor ich zu sprechen begonnen hatte. Dabei zitterten seine Augenlider und er schwieg. Er duckte sich, als wolle man ihn schlagen. Die Erscheinung seines Bewusstseins zeigte Ähnlichkeiten zu einer Demenz, denn an Wichtiges erinnerte er sich offensichtlich nicht. Einmal erzählte er uns von blauen, glitzernden Korallen, die Steine fräßen. Kurz danach stritt er das ab. Obwohl er mit seinem Auftreten Misstrauen erregte, verhielt er sich friedlich und brauchte keine Bewachung. Um sein Vertrauen zu gewinnen, gaben wir ihm so weit wie möglich Freiheiten. Die Türen zu den Gemeinschaftsräumen innerhalb unseres Gebäudes verschlossen wir nie. Speisen auf Tellern mit Besteck standen nach dem zweiten Tag immer für ihn bereit, so dass er sich nicht beobachtet fühlen musste, weil wir den Eindruck hatten, dass er beim Essen – es glich eher einem Vertilgen, denn er aß mit den Fingern – Zuschauer verabscheute.

 

Nach ein paar Tagen war er verschwunden, ohne einen für uns ersichtlichen Grund. Obwohl es fast aussichtslos war, suchte ich mit Suze in den Stadtteilen, die ihm Unterschlupf bieten könnten. Zuerst in den Produktionshallen, wo es hinter den Regalen die besten Versteckmöglichkeiten gab, dann in den Geschäften, in den Kuhställen, Gewächshäusern, Taubenschlägen und zuletzt im Forschungsgebäude für die Nanowindräder. Ohne Spur. Niemand hatte ihn gesehen, was Vermutungen auslöste, dass er als Spion aus einer anderen Welt gekommen wäre, und das Unbehagen vergrößerte. Er hatte uns eine Flasche mit einem flüssigen Inhalt, etwa einem dreiviertel Liter, auf dem Tisch in seinem Zimmer hinterlassen, ein verschlossenes Gefäß ohne Beschriftung, an dem außen braune Fäden klebten.

 

Dies hatte sich in der Forschungsstadt Gijutsu, Japan, ereignet, als ich meine Freunde besuchte. Suze, die Analytikerin, bei der ich ein paar Tage wegen einer Neuerung in den von mir entwickelten Farbstoffsolarzellen verbrachte, untersuchte den Flascheninhalt. Die salzige Brühe, die der Fremde aus dem Meer entnommen haben musste, enthielt Lebenszeichen, kubische Strudel, aber keine bekannten Strukturen, wie Suze unter ihrem Mikroskop, das an einen Bildabtaster gekoppelt war, erkannte. Deswegen ging sie mit einer Probe in das Labor eines befreundeten und in der Nähe wohnenden Biologen, der ihr seine Geräte und Reagenzien gerne zur Verfügung stellte, jedoch nicht helfen könne, wie er gleich mitteilte, da er am nächsten Tag zu einer Konferenz nach Kyoto müsse. Im Labor des Biologen fand sie in der Flüssigkeit eine hohe Konzentration an DNA, die an einen klaren Schleim, der sich drehte, gebunden war. Sonst konnte sie nichts entdecken, was auf Leben hindeutete: keine Algen, Pilze, Bakterien oder kleine Tiere. Noch während sie mit der Untersuchung beschäftigt war, rief sie mit leuchtenden Augen, sie würde nicht von dem Eindruck loskommen, dass sich die DNA während der Analyse vermehrt hätte, obwohl es doch keine Spuren von Zellen gäbe, die dazu notwendig wären. Suze warf ihre roten Haare nach hinten, freute sich, etwas Neuem auf der Spur zu sein, und hatte ein Heureka-Erlebnis. Als ich sie an den Fremden und an die unbekannte Herkunft der Probe erinnerte, schwieg sie. Mit erhobenem Kopf blickte sie wieder in das Reagenzglas und schüttelte es. Die entnommene Probe sei inzwischen zu einem ziemlich zähen Brei geworden, bemerkte sie. Trotzdem gelang es ihr, einen Teil der Reihenfolge der Basen in der DNA zu bestimmen. Eine merkwürdige DNA-Sequenz zeigte sich bereits auf dem Bildschirm, während das Programm noch rechnete. Der Code lautete: ‚ATCG*ACTG*ATTTGAGTAAGTAGGTAGGTGACTAATGACTAG‘,

wobei die ersten beiden G eine bisher unbeschriebene Modifizierung trugen. Zudem läge etwa ein Drittel der Moleküle doppelt zyklisch vor. Eine seltsame Geometrie, sagte Suze, und die Moleküle seien ineinander verknotet, wie sie das noch nie gefunden habe. Da könnte sich eine Spannung aufbauen, die für eine hinterhältige Vernichtungswaffe Energie lieferte.

 

Nach allem was ich bisher erfahren hatte, bezweifelte ich, dass es sich hier um eine, ich möchte fast sagen, irdische DNA und eine normale, euklidische Geometrie handelte. Ich wollte Suze aber nichts davon erzählen. Denn niemand von uns glaubte an Übernatürliches. Und meine Theorie einer DNA-Vermehrung in gekrümmten Räumen wagte ich auch nicht zu erwähnen.

 

Wir gingen in unser Gebäude zurück. Als Suze aus dem Glasgefäß, das der Fremde mitgebracht hatte, eine weitere Analyseprobe entnehmen wollte, begann es im Inneren zu blubbern, so dass wir uns ängstigten, den Kolben zu öffnen, ja nicht einmal, ihn zu berühren, wagten wir. Es befand sich fremdes Leben in unserem Haus, soviel war uns klar. Friedlich oder feindlich? Das war nicht klar und so beschlossen wir, das Teil ohne weitere Versuche zu beobachten. Lange saßen wir vor dem Gefäß, wechselten uns mit der Bewachung ab. Irgendwie schien das Wesen im Inneren unsere Anwesenheit zu spüren. Das Blubbern hörte bald auf und auch, nachdem wir uns ein paar Minuten entfernt hatten, sah die Brühe tot aus. Trotzdem befürchteten wir eine Explosion des Behälters oder Schlimmeres. Ein schleimiges Monster oder eine Masse aus Mikroben, die das Glas sprengen würde. Abwechselnd legte sich einer von uns ins Bett, der andere hielt Wache, eine Spritze mit Salzsäure und eine mit Natronlauge neben sich, um das Ding gegebenenfalls unschädlich zu machen.

 

Am nächsten Tag besuchte uns eine dunkelhäutige Gestalt, die sich als Professor Mutai vorstellte, mit schwarzen Haaren, die wie Schleimfäden am Kopf klebten, einer Oberlippenspalte und löchrigen Schneidezähnen. Weder Suze noch ich hatten je von ihm gehört. Während wir seinen salzigen Schweiß rochen, erzählte er uns, dass er einen Zwerg suche, ein heruntergekommenes Wesen, welchem man auf böse Weise in die Zunge und sogar in die Lunge geschnitten hätte. Professor Mutai hob die Stimme. Dieser Mann sei willenlos gemacht worden. Nur so konnte man ihm den Auftrag geben, eine neue Lebensform zu verbreiten. Das Abenteuer hätte auf einer Insel südlich des Muruora-Atolls begonnen.

Der Professor sei gleich aufgebrochen, um uns zu warnen. Wir sollten niemandem von dem Fremden erzählen. Auch die Anwesenheit von Professor Mutai in Gijutsu solle vorerst geheim bleiben. Je mehr Informationen über die fremde Macht verbreitet würden, desto aggressiver schlüge das Neue zu. Hier brach er ab und blickte auf die Regale mit Laborchemikalien, als suche er nach etwas. Wir fragten nach den Merkmalen des verschwundenen Mannes und rissen den Professor aus seinen Gedanken. Der Zwerg sei ein erfahrener Seemann gewesen, antwortete er und beschrieb jedes schmutzige Detail des Körpers, ohne Hinweise auf Wesen, Herkunft und Ausbildung der Person zu geben. Nach der Darstellung des Äußeren handelte es sich um den Mann, der uns besucht hatte. Name und Herkunft kannte der Professor nicht oder wollte sie uns nicht nennen. Er zuckte mit den Augen ohne uns anzublicken. Seine Hände zitterten.

 

Beim Abendessen erkundigte sich Professor Mutai, ob wir an Übernatürliches glauben würden. Noch ehe wir antworten konnten, fuhr er fort, indem er das Kinn hob und eine Augenbraue hochzog, dass Wissenschaftler wie wir nicht an Irrationales glauben könnten. Das wisse er. Das sei das Gefährliche an der Wissenschaft. Wir könnten die kommenden Gefahren nicht beurteilen und wären ihnen ausgeliefert.

 

Nach dem Essen wollte er wissen, ob bei uns krakenförmige Tiere wären, mit Armen wie Regenwürmer und menschlichen Körperteilen. Er wischte sich über ein Auge und blickte auf den Boden, während er weitersprach. Vor denen müssten wir uns hüten. Er würde versuchen, uns von ihnen zu befreien. Ansonsten wären wir verloren. Jeder in Gijutsu würde sterben, betonte er mit Nachdruck. Gijutsu sei das erste Ziel. Hier wolle man die moderne Forschung vernichten.

Suze erwähnte die Flasche mit der brodelnden Flüssigkeit. Das Gesicht des Professors erstarrte, noch ehe Suzes erster Satz beendet war. Dann riss er sich zusammen und erklärte uns, dass wir Schlimmes verhindern müssten. Suze und ich blickten uns fragend an. Mutai fuhr fort: Die Vernichtung der logischen Wissenschaften sei das Ziel einer aus der Tiefe des Meeres auftauchenden Macht, die bei uns angelangt wäre. Eine unlogische Geometrie aus dem hintersten Teil des Alls sei auf dem Wege, die Bewohner der Erde zu unterwerfen.

 

Suze brachte den Behälter, den der Fremde mitgebracht hatte, und zeigte ihn dem Professor, nachdem dieser darum gebeten hatte. Der Inhalt des Kolbens blubberte wieder. Suze erklärte Professor Mutai, der aufmerksam zuhörte, dass sie nach der Entnahme von etwa einem Milliliter das Gefäß wieder mit dem Schraubverschluss dichtgemacht hätte. Die Veränderungen, die Verschleimung und das Blubbern könnten mit dem Öffnen zu tun haben, meinte Suze. Ich schlug vor, das ganze Ding sofort in den Autoklav zu stellen und zu vernichten, wozu nach einer Pause auch der Professor riet. Nur Druck und Hitze könnten gemeinsam helfen, uns zu schützen, sagte er. So verbrachte die merkwürdige Struktur die Nacht im Autoklav und wir hofften, dass das Schmoren den Tod brächte.

 

Am folgenden Morgen beim Öffnen des Autoklavs trugen wir wie vorgeschrieben Plexiglas-Schutzbrillen und Gummihandschuhe. Als sich der Dampf verzogen hatte, entdeckte ich neben dem Autoklav am Boden zwei durchsichte Gallertfäden von etwa einem halben Zentimeter Durchmesser und fünf Zentimeter Länge. Es war undenkbar, dass sie aus der verschlossenen Flasche des Fremden hätten entweichen können. Der Professor starrte auf sie, während sein Blick zu gefrieren schien. Suze trat einen Schritt zurück. Ich hob die beiden Teile auf – Gott sei Dank trug ich Handschuhe – und legte sie in einen Stahlbehälter, der sich luftdicht zuschrauben ließ, und den ich vorher bereitgestellt hatte, falls die autoklavierte Masse nicht tot wäre. Die Schleimteile schienen sich zu bewegen, denn als ich den Behälter auf den Tisch stellte, wackelte er leicht, als ob wir eine Maus gefangen hätten. In dem Gefäß, das Suze aus dem Autoklav geholt hatte, ließen sich dagegen keine Bewegungen erkennen. Der Inhalt hatte sich verfestigt. Ich blickte in Suzes fragendes Gesicht, dann zum Professor. Dieser murmelte etwas vor sich hin und schaute ernst.

„Der alte Mann ist tot“, flüsterte er, „sie haben ihn bereits geholt.“ Mit einer Handbewegung deutete er uns an, dass wir ins Nebenzimmer sollten. Eine Kälte durchfuhr meinen Körper, während Suze und ich ihm folgten.

 

„Unser Universum verändert sich. Ein Forscher und Waghalsiger muss in die Südsee reisen und versuchen, die Ursache der merkwürdigen Phänomene und ein Zurück zu finden“, sagte der Professor, nachdem wir uns wieder an den Tisch gesetzt hatten.

Es müsse jemand aus Gijutsu sein, fuhr er fort. Niemand sonst hätte das nötige Wissen. Wir müssten einen Beginn ändern. Ich fühlte, worauf er hinauswollte, und vermutete, dass es kein Zurück gäbe und wir das unkonventionelle Leben nicht komplett vernichten könnten, während ich auf den Stahlbehälter mit dem gallertfädigen Inhalt blickte, der nicht aufhörte, zu wackeln.

Nach einer kurzen Diskussion beschlossen wir, dass nur ich es sein könne, um nach der Ursache zu suchen, denn ich wäre ohnehin auf Wanderschaft und eine Reise in die Südsee würde meinem unruhigen Wesen entgegenkommen. Zudem lobte Suze meine naturwissenschaftlichen Kenntnisse, Kampferfahrenheit und emotionale Stabilität. Es war leicht, jemanden, den die Geschichte des Professors neugierig gemacht hatte, zu überreden. Auf alle Fälle solle ich allein reisen, widerholte der Professor und warnte, dass die dort lebenden Wesen bei Erkennen von menschlicher Sprache die beteiligten Personen sofort grausam vernichten würden.

„Sprechen Sie niemals in Anwesenheit krakenförmiger Lebewesen“, mahnte er, wobei seine Augen tränten. Er hätte gesehen, wie drei Leute mit einem grässlichen Schleim überzogen am Boden liegend vor Schmerzen geschrien hätten und erstickt wären. Es sei äußerst klug und aufmerksam von uns gewesen, niemandem von dem Gefäß und dessen Inhalt zu erzählen. So hätten wir eine sinnlose Forschung, die sich im Unbekannten verlaufen und nur Furcht ausgelöst hätte, verhindert. Es begann plötzlich unangenehm zu riechen, nach Fäulnis und Buttersäure. Ich öffnete das Fenster. Von draußen kam der Gestank nicht. In der Küche roch es nach Spülmittel. Der Professor meinte, dass wir mit dem Herumschnüffeln aufhören und uns beeilen sollten, die Reise zu planen.

 

Suze besorgte mir eine Laserpistole und einen in Gijutsu entwickelten, neuartigen Polymeranzug. Diese Bekleidung sei leicht und ließe nur Gase durch, erklärte sie. Dann bat sie mich um eine Unterhose und nähte eine Selbstmordpille hinein.

Wir hätten hier in Gijutsu ein Projekt über fragmentiertes Leben, so dass wir versuchen könnten, die merkwürdige DNA der Schleimwesen zu zerschneiden, ergänzte ich.

Das würde nichts helfen, antwortete Professor Mutai, wir hätten es mit veränderten Naturgesetzen zu tun. Wir müssten den Kern zerstören, nachdem wir die Gesetze der anderen Welt verstanden hätten. Das oberste Ziel der neuen Macht sei es, jeden zu töten, der irgendetwas über sie in Erfahrung brächte. Er blickte angespannt auf den Behälter, der im Autoklav gestanden hatte und an dem sich jetzt Kondenswasser bildete. Seine Brille hielt er in der Hand. Der Professor erschien mir noch merkwürdiger. War er wirklich derjenige, für den er sich ausgab?

Nach einer Weile flüsterte er gedankenversunken, wobei er abwechselnd mit erweiterten Pupillen auf die autoklavierte Masse starrte, dann auf den Stahlbehälter, in dem die Gallertfäden nicht zur Ruhe kamen.

„Es ist nicht tot, was ewig liegt. Und in fremder Zeit wird selbst der Tod besiegt.“

Dann sah er mich mit wässrigen Augen an, während mich seine geheimnisvolle Aussage beschäftigte. Er könnte damit gemeint haben, dass die Lebensformen in den beiden Gefäßen das ewige Leben hätten. Doch meine Zeit reichte nicht, weiter darüber nachzudenken.

 

Der Professor schrie, als ob ihn ein blitzartiger Schmerz durchschlug. Ruckartig senkte er den Kopf und sah, als bedrohe ihn ein Raubtier, hinunter zu seinen Füssen. Eine Schleimspur glänzte auf seinen Schuhen, die sich unter die Hose zu bewegen schien. Der Professor setzte sich auf den nächsten Stuhl. Er zog sein Hemd aus und wir entdeckten, dass der kriechende Schleim schon am Hals angekommen war. Mein Herz schlug wie noch nie. Ich wusste nicht, was ich tun sollte. Suze rannte ins Labor. Der Professor krümmte sich und drohte vom Stuhl zu fallen. Ich stützte ihn und sah mit größtem Entsetzen den Schleim in den Mund des Professors kriechen. Ich griff nach dem Schleim trotz meiner Angst, er bliebe an mir kleben; doch ich konnte ihn nicht greifen. Meine Finger rutschten. Es war unmöglich, den Schleim vom Körper des Professors zu reißen. Der Professor gluckste und schluckte; dann würgte er, wie wenn er erbrechen müsste. Ein fauliger Geruch kam mir entgegen, so wie bereits zuvor. Ich konnte den Professor nicht mehr halten. Er fiel vom Stuhl. Als Suze mit einer Flasche Alkohol zurückkam, war er bereits tot.

 

Das Fremde hatte uns gezeigt, wie es tötete. Suze war außer Atem und ich fühlte kalten Schweiß auf meinem Rücken. Die Leiche des Professors musste sofort vernichtet werden, denn etwas Ansteckendes war bei uns. Wir hievten die Leiche in den Autoklav und konnten nur hoffen, dass wir uns nicht infizierten oder das Neue uns noch nicht befallen hatte. Suzes Voraussicht, den größtmöglichen Autoklav anzuschaffen, hatte sich bewährt. Sie fragte, ob der Professor das Böse bereits an sich getragen hätte, bevor er zu uns gekommen wäre, oder ob der Zwerg die tödlichen Lebensformen bewusst oder unbewusst bei uns eingeführt hätte. Wir fanden keine Antwort. Die Existenzen der Forscher in Gijutsu und vielleicht die aller Menschen waren bedroht. Konnten wir dieses seltsame Leben durch Autoklavieren vernichten? Für mich galt es, keine Zeit zu verlieren und ich organisierte meine Reise in die Südsee. Suze blieb in Gijutsu zurück, als einzige, die von der Gefahr wusste und notfalls in Gijutsu helfen könnte, mit Druck und Hitze, Säuren oder Laugen. Auch den Stahlbehälter mit den wurmförmigen Teilen hatten wir inzwischen autoklaviert. Trotzdem surrte es noch aus seinem Inneren und wir hielten ihn verschlossen.

Meine Sorgen um Suze und die anderen wuchsen, als ich Gijutsu verließ. Am Flughafen Kansai wollte ich bereits umkehren. Dann siegte der Mut. Ich stieg ins Flugzeug, denn ich war mir bewusst, was von mir abhing.

 

Getrieben von einer Art Mischung aus Wissensdurst und Angst fuhr ich mit einem Boot, wie es Professor Mutai verlangt hatte, alleine zu den Inseln des Muruora-Atolls, die ich zum ersten Mal kennenlernte. Ich ruhte mich dort aus, genoss die Sonne und das Seepanorama, füllte den Wasserbehälter und plante dann meinen weiteren Kurs. Alles war normal. Ich gab endlich die südlicheren und letzten Koordinaten, die mir Professor Mutai gegeben hatte, in mein Navigationssystem ein: 47 Grad 9 Minuten südliche Breite und 123 Grad 42 Minuten westliche Länge. Dann drehte ich die Solarzellen für den Motor des Bootes in einen Winkel, dass die Sonne senkrecht auf die Oberfläche schien. Ich fuhr nun mit maximaler Geschwindigkeit. Die Wellen waren so niedrig, dass ich auf dem Smartphone eine längere Nachricht an Suze eintippen und ihr schicken konnte.

Nach einem weiteren Tag auf See spürte ich eine Gegenströmung, so dass ich nur langsam vorankam. Ein paar Stunden später näherten sich mir anomale Wellen. Sie entstanden aus Strudeln und wechselten ihre Richtungen. Sie hoben mein Boot etwas hoch und bildeten hinter mir eine Mauer aus Wasser. Vor mir erschien hellgrünes Licht aus dem Meer. Dann saugte eine Kraft das Boot nach unten. Ich fühlte keinen Kontakt zum Wasser. Zuerst dachte ich, dass es ein Effekt des Polymeranzugs wäre. Jedoch konnte ich atmen – unter Wasser – und ich fühlte keinen Druck. Plötzlich befand ich mich wieder oben auf dem Meer, so trocken, als wäre ich nie darunter gewesen. Das hellgrüne Licht war weg. Rundherum war Nebel, in dem eine Insel erschien. Ich steuerte das Boot auf den dunklen Sand- oder Schlammstrand.

 

Ich lief in Richtung der ersten Palme, die sich zum Land hin krümmte. Auch die Palmen dahinter waren verbogen, wie wenn sie etwas verbergen würden. Eine berauschende Neugierde trieb mich an und überwuchs Angst und Bedenken. Doch kam ich nur langsam vorwärts, denn meine Füße versanken teilweise bis zu den Waden im Schlamm und ich brauchte alle Kraft, um sie mit einem glucksenden Geräusch herauszuziehen. Aus der Nähe erkannte ich, dass aus den violett-braunen Stämmen der Palmen im oberen Bereich Ausstülpungen gewachsen waren, die sich wie Finger bewegten. Ich getraute mich nicht, diese Fingerbeulen zu berühren. An einer klebte eine blaue, libellenartige Struktur. Ansonsten war weder etwas Besonderes zu sehen noch zu hören und trotzdem fühlte ich mich von der unheimlichen Umgebung bedroht. Ich drehte um, holte das Boot, zog es durch den Schlamm und band es unten an einer Palme fest, nachdem ich die Solarzellen und Windräder unter dem Heck verstaut hatte. Jetzt getraute ich mich, mit Speck aus Gijutsus Schweinezellkultur und anderem Proviant im Rucksack, ins Innere der Insel. Der Boden wurde härter und der Pflanzenbewuchs dichter. Nach ein paar Metern stand ich in einem Wald aus Palmen und anderen meterhohen Stauden. Doch es waren befremdliche Pflanzen, solche, die ich nicht einmal von Bildern her kannte, obwohl ich eigentlich von meiner Ausbildung her alle Gattungen zumindest kennen sollte. So besaß eines dieser fremdländischen Gewächse wurstförmiges, blaues Laub und roch nach ranziger Butter. Über meinem Kopf hingen dreieckige, fast schwarze Blätter einer anderen Pflanze. Dann sah ich Sträucher, deren Äste ineinander verdreht waren und dabei eigentümliche Knoten bildeten. Das Schlimmste aber waren bewegliche Dornen an brombeerähnlichen Zweigen. Blickte ich auf den Busch, so traten die Dornen aus dem Inneren der Triebe hervor und glitten den Zweigen entlang in meine Richtung. Sie versperrten den weiteren Weg in den Wald. Nur Ausweichen war möglich – das einzige, neue Ziel war eine Wiese, die sich hinter dem seltsamen Wald zeigte – und ich stolperte über Löcher im Boden. In weiter Ferne erkannte ich die Umrisse eines Felsens. Keuchend blieb ich am Waldrand stehen. Dann vernahm ich ein Geräusch. Worte formten sich aus dem Unteren. Sie drangen aus einem der Löcher: „Ph’nglui mglw’nafh Cthulhu R’lyeh wgah’nagl fhtagn“, oder so ähnlich flüsterte jemand. Ich blickte um mich, wollte wegrennen, doch ich konnte vor Schreck meine Beine nicht bewegen.

„Sie sind ein ungeladener Gast und hier nicht willkommen,“ hörte ich aus dem Boden kommend. Die Stimme sprach diesmal verständlich und klar in meiner Sprache. Trotz meiner Angst und Verwirrung erkannte ich, dass die Stimmen verschieden waren. Die erste hatte fremd, künstlich oder synthetisch geklungen, die zweite Stimme dagegen menschlich, so als ob ein Mann gesprochen hätte. Ich suchte den Boden nach den Quellen der Stimmen ab, fand jedoch keine Hinweise. Aus den Löchern grub ich nur schwarze, klebrige Erde aus. Die Worte der Stimme wiederholten sich in meinem Koop und mir wurde schwindelig. Während ich angetrockneten Schlamm von meinen Waden kratzte, schmerzten meine schmutzigen Finger. Die Beine waren vom Marsch durch den Sumpf und Wald lahm geworden und so erschöpfte sich mein Wille, dass ich mich ins Gras legte und eingeschlafen sein musste. Ich hatte es nicht mehr geschafft, Suze eine Nachricht zu schicken.

 

Nachdem ich mit einem Riesenhunger aufgewacht war und mich aus meinem Proviant mit Speck und Wasser gestärkt hatte, tippte ich auf meinem Smartphone eine Nachricht für Suze, ohne meine Umgebung genauer zu betrachten. Die Nachricht war mir wichtiger. Aber es gab keine Verbindung. Beim Drücken der Sendetaste hörte ich ein Brummen. Dann erschienen merkwürdige Zeichen auf dem Bildschirm: Kreise und Ellipsen, die sich überlappten. Hatte ich Kontakt? Falls ja, mit wem? Mit Schrecken erkannte ich, dass ich von der normalen Welt abgeschnitten war und alleine zurechtkommen musste. Ich entschied mich, auf der Wiese weiter in Richtung des glitzernden Felsens zu laufen, und packte den Rucksack. Etwas Anderes fiel mir jetzt erst auf, als ich in die Ferne sah. Ich war zu vertieft in den Versuch gewesen, Suze meine Erlebnisse zu berichten. Nach meinem Zeitgefühl hätte es früher Morgen sein sollen. Das Licht war hell, aber so, als käme es von unten und den Seiten. Der Himmel erschien dunkel. Ein oranger Mond und trübe Sterne bewegten sich hinter einem Nebel, als änderten sich die Schwerkräfte des Alls. Neben mir raschelte es. Ich erschrak, weil ich eher eine Stimme von unten erwartete. Aber ein Wesen hatte sich mir heimlich von hinten genähert. Ich blieb stehen, um die schattenhafte Gestalt zu beobachten. Eines war sicher: So eine Kreatur hatte ich noch nie gesehen. Sie glich einem Kraken. Ganz deutlich erkannte ich Fangarme. Ein Krake, der auf der Wiese herumlief, etwas grösser als ein Kaninchen, und sich auf sechs der etwa zwanzig Tentakeln fortbewegte. Das Biest stand jetzt direkt vor mir und schien mich zu mustern. Eine Kugel mit Armen. Zwei grüne Augen, die oben etwas aus dem Rumpf ragten, blickten mich seitlich an. Dann sank mein Herz und stach in meinen Bauch, so dass ich mich nach vorn krümmte. Der Krake hatte die Fangarme gehoben und sie offenbarten das makaberste und schaurigste Bild, das ich mir nie hätte so vorstellen können. An den Spitzen der Fangarme wuchsen oder hingen Finger, Zehen, Nasen, Ohren und andere Menschenteile, sogar Geschlechtsorgane. Ich griff zu meiner Laserpistole und hielt sie schussbereit, während ich das Monster weiter betrachtete. Die Menschenteile an den Tentakeln glichen Resten einer Mahlzeit. Am Ende eines mittleren Fangarms hing eine Knolle, die mich wie ein Auge anstarrte. Ich zuckte zusammen. Gelbe Ränder umschlossen gezackte Pupillen. Es war unverkennbar das Auge des Fremden, der in Gijutsu verschwunden war. Ich war so schockiert, dass ich mich kaum getraute zu atmen. Das Tier wühlte jetzt mit den Armen, an denen keine Menschenteile hafteten, im Boden und verschwand innerhalb von ein paar Sekunden in einem Loch. Schneller als bei einer Wühlmaus flog Erde aus der Grube, bis die Öffnung verschlossen war. Ich konnte nur zuschauen, staunen und mich fürchten.

 

Als ich mich von dem Schrecken erholt hatte und meinen Weg fortsetzen wollte, vernahm ich ein Fauchen und Stampfen hinter mir aus Richtung des Waldstreifens mit den sonderbaren Pflanzen, als ob sich ein Mischwesen aus Büffel und Leopard näherte. Ich drehte mich blitzartig um. Das, was ich jetzt sah, überstieg meine Phantasie und glich einem Alptraum. Ich fühlte mich klein und kraftlos, zu schwach, um wegzurennen. Mein Herz pumpte so stark es konnte. Ein Ungeheuer – grösser als ich – mit Tintenfischhaupt, Drachenleib und seltsamen Flügeln stand vor mir. Erst dachte ich, es wären Federn, aber über den ganzen Körper der Bestie wuchsen spitze, braun-grüne Schuppen ähnlich einem Reptil. Auch aus den Flügeln ragten lange Schuppen, die wie zum Schwimmen geschaffen aussahen. Da wusste ich, dass die Flügel auch die Funktion von Flossen hatten, und das Geschöpf die meiste Zeit im Wasser leben musste.

„Du bist mutig. Unter uns liegt R’lyeh, die Hauptstadt meines Reiches“, begann eine tiefe Stimme. Das Wesen wippte beim Sprechen mit dem Kopf. Im Maul erkannte ich spitze, hellbraune Zähne.

„Ich bin Cthulhu.“ Das Tierwesen schob die Schuppen von den Augen und es erschien eine rote Iris. „Warum bist du hier?“, fragte es weiter. Es handelte sich ohne Zweifel um die zweite Stimme, die ich aus dem Boden gehört hatte. Ich war ganz sicher und konnte vor Schreck nicht antworten. In meinem Kopf wirbelten Phantasien, wie sie es bei äußerster Anspannung tun. Ich erinnerte mich an Professor Mutais Warnung: Beim Erkennen menschlicher Sprache töteten die Ungeheuer. Schweigen wäre meine Waffe. Dann erschien in meinen Gedanken das Bild der mit Schleim bedeckten Leiche des Professors.

„Warum antwortest du nicht?“, brüllte der Drache und schlug mit den Flügeln auf und ab. Ich dürfte auf keinen Fall antworten. Trotzdem war ich wehrlos. Das Monster hob vom Boden ab und flog auf mich zu. Ich griff nach der Laserpistole.

„Du kannst mir nicht entkommen!“, schrie die Bestie, während sie über mich in Richtung des Felsens flog. Ich wunderte mich, wie schnell sie vom Boden abgehoben hatte. „Du bist doch ein Mensch!“, hallte es nach und ich wusste, dass ich dieser Kreatur ausgeliefert war. In der Ferne landete der Drache auf dem Meer und tauchte ab. Diesmal ließ er mich gehen. Aber das absonderliche Erlebnis und die scheinbare Erleichterung machten mich trotz des Schocks wissbegieriger.

Details

Seiten
160
Jahr
2018
ISBN (eBook)
9783738922110
Sprache
Deutsch
Erscheinungsdatum
2018 (August)
Schlagworte
falle kräfte
Zurück

Titel: In der Falle rätselhafter Kräfte